Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 4030111
End position: 4030137
Length: 27

DNA sequence
>NC_016856, from 4030111 to 4030137 (27 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4030011-4030223	Sequence	STM14_4608 ccmD_2 heme exporter protein C (Protein is coded in complementary strand; from 4030223 to 4030011)