Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 3826475
End position: 3826498
Length: 24

DNA sequence
>NC_016856, from 3826475 to 3826498 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3826035-3826937	Sequence	STM14_4372 dppC dipeptide transporter (Protein is coded in complementary strand; from 3826937 to 3826035)