Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 3736141
End position: 3736164
Length: 24

DNA sequence
>NC_016856, from 3736141 to 3736164 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S ATGCAGACGCAGATGCAAACGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3736028-3736444	Sequence	STM14_4278 yhhA hypothetical protein