Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 3484388
End position: 3484411
Length: 24

DNA sequence
>NC_016856, from 3484388 to 3484411 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S TCGCTTTCGCTTTCTCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3484114-3485286	Sequence	STM14_3988 obgE GTPase ObgE (Protein is coded in complementary strand; from 3485286 to 3484114)