Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 2926773
End position: 2926802
Length: 30

DNA sequence
>NC_016856, from 2926773 to 2926802 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S TAGCCGCGATTTGCCGCGATTTGCCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2926750-2927154	Sequence	STM14_3331 - putative transposase (Protein is coded in complementary strand; from 2927154 to 2926750)