Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 2788015
End position: 2788038
Length: 24

DNA sequence
>NC_016856, from 2788015 to 2788038 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S CGCTGCGGCTGCCGATGCGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2786255-2788627	Sequence	STM14_3170 - tail fiber-like protein (Protein is coded in complementary strand; from 2788627 to 2786255)