Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 2623780
End position: 2623809
Length: 30

DNA sequence
>NC_016856, from 2623780 to 2623809 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2622922-2624109	Sequence	STM14_3019 eutG putative transport protein (Protein is coded in complementary strand; from 2624109 to 2622922)