Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 245488
End position: 245514
Length: 27

DNA sequence
>NC_016856, from 245488 to 245514 (27 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S CGGCGGTAACGGCGGCAACGGCGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 245196-246623	Sequence	STM14_0249 htrA serine endoprotease