Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 203
End position: 226
Length: 24

DNA sequence
>NC_016856, from 203 to 226 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S CACCACCACCATTACCACCATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 190-255	Sequence	STM14_0001 thrL thr operon leader peptide