Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 198421
End position: 198465
Length: 45

DNA sequence
>NC_016856, from 198421 to 198465 (45 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S GGCGAGATGGATCATGGCAACATGGATCACAGCGGGATGAATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 197237-198847	Sequence	STM14_0200 cueO multicopper oxidase