Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 190
End position: 255
Length: 66

DNA sequence
>NC_016856, from 189 to 254 (66 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S ATGAACCGCATCAGCACCACCACCATTACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA

Protein sequence (NCBI) or Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 190-255	Sequence	STM14_0001 thrL thr operon leader peptide