Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 1194094
End position: 1194123
Length: 30

DNA sequence
>NC_016856, from 1194094 to 1194123 (30 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1193154-1194308	Sequence	STM14_1315 mdoC glucans biosynthesis protein (Protein is coded in complementary strand; from 1194308 to 1193154)