Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 1119726
End position: 1119749
Length: 24

DNA sequence
>NC_016856, from 1119726 to 1119749 (24 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S GGAGCCGGAGCTGGTGCCGGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1119309-1120361	Sequence	STM14_1214 ompA outer membrane protein A (Protein is coded in complementary strand; from 1120361 to 1119309)