Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Start position: 3735927
End position: 3736031
Length: 105

DNA sequence
>NC_016856, from 3735927 to 3736031 (105 bp); Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S GTGTATGTCCCGTTTAATCCTGGCCCACAACGCTTAAAAAATCATCATCATGGCGAAATAGAGGTACACT TAAAAAGAGGCCTCATCGGGAGGAGACGACAATGA

Protein sequence (NCBI) or Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3735927-3736031	Sequence	STM14_4277 - hypothetical protein
ORF... 3736028-3736444	Sequence	STM14_4278 yhhA hypothetical protein