Sequence retrieval

Genome: Treponema pallidum subsp. pallidum DAL-1
Start position: 395645
End position: 395698
Length: 54

DNA sequence
>NC_016844, from 395645 to 395698 (54 bp); Treponema pallidum subsp. pallidum DAL-1 ATCGTCGTCTTCAAAGTCATCGTCATCGTCAAAGCCATCCTCGTCTTCAAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 395601-395882	Sequence	TPADAL_0370 - hypothetical protein (Protein is coded in complementary strand; from 395882 to 395601)