Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 830700
End position: 830726
Length: 27

DNA sequence
>NC_016822, from 830700 to 830726 (27 bp); Shigella sonnei 53G TGCCAGATCTGCCAGATCTGCCAGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 830016-831158	Sequence	SSON53_04240 - putative ABC transporter permease (Protein is coded in complementary strand; from 831158 to 830016)