Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 745097
End position: 745141
Length: 45

DNA sequence
>NC_016822, from 745097 to 745141 (45 bp); Shigella sonnei 53G AGAAAGCAGCGGCAGAAAAAGCCGCCGCAGACAAAAAAGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 744395-745627	Sequence	SSON53_03700 tolA cell envelope integrity inner membrane protein TolA