Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 4648810
End position: 4648863
Length: 54

DNA sequence
>NC_016822, from 4648810 to 4648863 (54 bp); Shigella sonnei 53G AAAAGAAATCTTTAGCATAAGAAAAATCTTTGGCATAAGAAAAATCTTTGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4648425-4648946	Sequence	SSON53_24480 - hypothetical protein (Protein is coded in complementary strand; from 4648946 to 4648425)