Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 4435803
End position: 4435826
Length: 24

DNA sequence
>NC_016822, from 4435803 to 4435826 (24 bp); Shigella sonnei 53G AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4435096-4436130	Sequence	SSON53_23420 - rhamnose-proton symporter (Protein is coded in complementary strand; from 4436130 to 4435096)