Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 4317213
End position: 4317266
Length: 54

DNA sequence
>NC_016822, from 4317213 to 4317266 (54 bp); Shigella sonnei 53G GGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4317174-4318397	Sequence	SSON53_22825 - putative uroporphyrinogen III C-methyltransferase (Protein is coded in complementary strand; from 4318397 to 4317174)