Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 261169
End position: 261204
Length: 36

DNA sequence
>NC_016822, from 261169 to 261204 (36 bp); Shigella sonnei 53G CTCTGACTCTGACTCTGACTCTGACTCTGACTCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 259988-262777	Sequence	SSON53_01235 - ATP-dependent Clp proteinase ATP-binding chain (Protein is coded in complementary strand; from 262777 to 259988)