Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 2610278
End position: 2610302
Length: 25

DNA sequence
>NC_016822, from 2610278 to 2610302 (25 bp); Shigella sonnei 53G ACGGAACAGATCGGAACGAATCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2609928-2610860	Sequence	SSON53_13935 - N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase (Protein is coded in complementary strand; from 2610860 to 2609928)