Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 2103015
End position: 2103038
Length: 24

DNA sequence
>NC_016822, from 2103015 to 2103038 (24 bp); Shigella sonnei 53G ACCTTGTTACCTAGTTACCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2103022-2103843	Sequence	SSON53_11310 - antitermination protein Q-like protein (Protein is coded in complementary strand; from 2103843 to 2103022)