Sequence retrieval

Genome: Shigella sonnei 53G
Start position: 1079694
End position: 1079717
Length: 24

DNA sequence
>NC_016822, from 1079694 to 1079717 (24 bp); Shigella sonnei 53G ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1079629-1080801	Sequence	SSON53_05440 - trimethylamine N-oxide reductase cytochrome c-type subunit