Sequence retrieval

Genome: Chlamydia trachomatis A2497
Start position: 653376
End position: 653411
Length: 36

DNA sequence
>NC_016798, from 653376 to 653411 (36 bp); Chlamydia trachomatis A2497 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 652375-653838	Sequence	CTR_5811 copB putative type III secretion system membrane protein