Sequence retrieval

Genome: Chlamydia trachomatis A2497
Start position: 57094
End position: 57117
Length: 24

DNA sequence
>NC_016798, from 57094 to 57117 (24 bp); Chlamydia trachomatis A2497 TCCGGTTCAGGTTCAGGTTCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 56125-57873	Sequence	CTR_0491 - hypothetical protein (Protein is coded in complementary strand; from 57873 to 56125)