Sequence retrieval

Genome: Chlamydia trachomatis A2497
Start position: 336332
End position: 336355
Length: 24

DNA sequence
>NC_016798, from 336332 to 336355 (24 bp); Chlamydia trachomatis A2497 TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 336352-339156	Sequence	CTR_2961 pknD Serine/threonine-protein kinase (Protein is coded in complementary strand; from 339156 to 336352)