Sequence retrieval

Genome: Brucella suis VBI22
Start position: 86999
End position: 87022
Length: 24

DNA sequence
>NC_016797, from 86999 to 87022 (24 bp); Brucella suis VBI22 ACTGCCCTACTGCCCTACTGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 87014-87397	Sequence	BSVBI22_A0081 - hypothetical protein (Protein is coded in complementary strand; from 87397 to 87014)