Sequence retrieval

Genome: Brucella suis VBI22
Start position: 736313
End position: 736360
Length: 48

DNA sequence
>NC_016797, from 736313 to 736360 (48 bp); Brucella suis VBI22 TCCCTTACTCCCTTACTCCCTTACTCCCTTACTCCCTTACTCCCTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 736358-737515	Sequence	BSVBI22_A0746 rnd ribonuclease D (Protein is coded in complementary strand; from 737515 to 736358)