Sequence retrieval

Genome: Brucella suis VBI22
Start position: 62809
End position: 62856
Length: 48

DNA sequence
>NC_016797, from 62809 to 62856 (48 bp); Brucella suis VBI22 ACTGCCCTACTGCCCTACTGCCCTACTGCCCTACTGCCCTACTGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 62856-63251	Sequence	BSVBI22_A0056 - glyoxalase family protein (Protein is coded in complementary strand; from 63251 to 62856)