Sequence retrieval

Genome: Brucella suis VBI22
Start position: 1960836
End position: 1960871
Length: 36

DNA sequence
>NC_016797, from 1960836 to 1960871 (36 bp); Brucella suis VBI22 TGATCGTTATGATGATCGTGATGGTGATCGTGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1960431-1961603	Sequence	BSVBI22_A2031 - cobalamin synthesis protein/P47K family protein (Protein is coded in complementary strand; from 1961603 to 1960431)