Sequence retrieval

Genome: Brucella suis VBI22
Start position: 1903846
End position: 1903881
Length: 36

DNA sequence
>NC_016797, from 1903846 to 1903881 (36 bp); Brucella suis VBI22 ATGAAACCCGCAATGAAACCTGTAATGAAACCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1903482-1903847	Sequence	BSVBI22_A1969 - 6-pyruvoyl tetrahydrobiopterin synthase
ORF... 1903847-1904602	Sequence	BSVBI22_A1970 - radical activating enzyme