Sequence retrieval

Genome: Brucella suis VBI22
Start position: 1483892
End position: 1483915
Length: 24

DNA sequence
>NC_016797, from 1483892 to 1483915 (24 bp); Brucella suis VBI22 CCGGCTCCGCCTCCGGCTTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1483336-1484877	Sequence	BSVBI22_A1528 - hypothetical protein (Protein is coded in complementary strand; from 1484877 to 1483336)