Sequence retrieval

Genome: Brucella suis VBI22
Start position: 1214832
End position: 1214867
Length: 36

DNA sequence
>NC_016797, from 1214832 to 1214867 (36 bp); Brucella suis VBI22 GCGGCAGCAGCAGGGGCAGCGCCACCGGCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1214613-1214987	Sequence	BSVBI22_A1241 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1214987 to 1214613)