Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 545215
End position: 545241
Length: 27

DNA sequence
>NC_016790, from 545215 to 545241 (27 bp); Corynebacterium diphtheriae VA01 ACGATCTACACGATCTTCACGATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 545213-546445	Sequence	CDVA01_0525 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 546445 to 545213)