Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 510934
End position: 510960
Length: 27

DNA sequence
>NC_016790, from 510934 to 510960 (27 bp); Corynebacterium diphtheriae VA01 CTGGAAGGCATGGAAGGCATGGAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 510787-512244	Sequence	CDVA01_0494 mscS small-conductance mechanosensitive channel (Protein is coded in complementary strand; from 512244 to 510787)