Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 240918
End position: 240949
Length: 32

DNA sequence
>NC_016790, from 240918 to 240949 (32 bp); Corynebacterium diphtheriae VA01 CCACGATCCCGCGATCCCGCGATCCCACGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 240222-241265	Sequence	CDVA01_0228 - hypothetical protein (Protein is coded in complementary strand; from 241265 to 240222)