Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 2351912
End position: 2351947
Length: 36

DNA sequence
>NC_016790, from 2351912 to 2351947 (36 bp); Corynebacterium diphtheriae VA01 GGTGCTGCTGGTCCTGCTGGTGCTGCTGGTGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2350458-2352029	Sequence	CDVA01_2153 ulaA PTS system ascorbate-specific transporter subunit IIC