Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 2243038
End position: 2243061
Length: 24

DNA sequence
>NC_016790, from 2243038 to 2243061 (24 bp); Corynebacterium diphtheriae VA01 CTTCGGCTGCGGCTGCGGCTTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2242416-2243906	Sequence	CDVA01_2057 - putative sodium/alanine symporter (Protein is coded in complementary strand; from 2243906 to 2242416)