Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 1941007
End position: 1941033
Length: 27

DNA sequence
>NC_016790, from 1941007 to 1941033 (27 bp); Corynebacterium diphtheriae VA01 GTCGACTCTGGCGACTCTGTCGACTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1940269-1941669	Sequence	CDVA01_1803 - putative secreted protein (Protein is coded in complementary strand; from 1941669 to 1940269)