Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 1749876
End position: 1749899
Length: 24

DNA sequence
>NC_016790, from 1749876 to 1749899 (24 bp); Corynebacterium diphtheriae VA01 CAGGCGCAGGGGCAGGCGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1749458-1750075	Sequence	CDVA01_1630 - putative secreted protein (Protein is coded in complementary strand; from 1750075 to 1749458)