Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 1454796
End position: 1454840
Length: 45

DNA sequence
>NC_016790, from 1454796 to 1454840 (45 bp); Corynebacterium diphtheriae VA01 GTGCTGCTGGCTTAGGCGCAGCTGGTTTAGGAGCCGCAGGCTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1452374-1455235	Sequence	CDVA01_1360 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 1455235 to 1452374)