Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 380118
End position: 380147
Length: 30

DNA sequence
>NC_016645, from 380118 to 380147 (30 bp); Pyrobaculum sp. 1860 CGTCGACGTCCACGTCCACCTCGACGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 379979-380254	Sequence	P186_0435 - hypothetical protein (Protein is coded in complementary strand; from 380254 to 379979)