Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 2231258
End position: 2231281
Length: 24

DNA sequence
>NC_016645, from 2231258 to 2231281 (24 bp); Pyrobaculum sp. 1860 TTCACCTTCAGCTCCACCGTCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2231105-2231530	Sequence	P186_2665 - thioesterase superfamily protein (Protein is coded in complementary strand; from 2231530 to 2231105)