Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 2058245
End position: 2058274
Length: 30

DNA sequence
>NC_016645, from 2058245 to 2058274 (30 bp); Pyrobaculum sp. 1860 GAAAGAGGTGGAAAGAGGTAGAAAGAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2057993-2058478	Sequence	P186_2469 - hypothetical protein (Protein is coded in complementary strand; from 2058478 to 2057993)