Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 2017300
End position: 2017323
Length: 24

DNA sequence
>NC_016645, from 2017300 to 2017323 (24 bp); Pyrobaculum sp. 1860 CCGCCACGGCCACCTCCACCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2017170-2017454	Sequence	P186_2420 - phosphoribosyl-ATP pyrophosphohydrolase (Protein is coded in complementary strand; from 2017454 to 2017170)