Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 1993417
End position: 1993440
Length: 24

DNA sequence
>NC_016645, from 1993417 to 1993440 (24 bp); Pyrobaculum sp. 1860 GGCGGCGGCGGGGGCGCCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1992866-1994065	Sequence	P186_2393 - fructose-1,6-bisphosphatase (Protein is coded in complementary strand; from 1994065 to 1992866)