Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 1568351
End position: 1568374
Length: 24

DNA sequence
>NC_016645, from 1568351 to 1568374 (24 bp); Pyrobaculum sp. 1860 GCGGCGGCGGCGCCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1568240-1569487	Sequence	P186_1864 - putative inner membrane protein (Protein is coded in complementary strand; from 1569487 to 1568240)