Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 1362394
End position: 1362417
Length: 24

DNA sequence
>NC_016645, from 1362394 to 1362417 (24 bp); Pyrobaculum sp. 1860 CCTCCACCACCACCTCCACCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1362306-1364132	Sequence	P186_1617 - putative ATPase (Protein is coded in complementary strand; from 1364132 to 1362306)