Sequence retrieval

Genome: Pyrobaculum sp. 1860
Start position: 1194176
End position: 1194199
Length: 24

DNA sequence
>NC_016645, from 1194176 to 1194199 (24 bp); Pyrobaculum sp. 1860 TCTCCTCTTCTCGTCTTCTCCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1193729-1194199	Sequence	P186_1414 - secreted endonuclease-like protein (Protein is coded in complementary strand; from 1194199 to 1193729)